Review



3x myc egfp omp25  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc 3x myc egfp omp25
    3x Myc Egfp Omp25, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3x myc egfp omp25/product/Addgene inc
    Average 93 stars, based on 18 article reviews
    3x myc egfp omp25 - by Bioz Stars, 2026-03
    93/100 stars

    Images



    Similar Products

    3x myc egfp omp25  (Addgene inc)
    93
    Addgene inc 3x myc egfp omp25
    3x Myc Egfp Omp25, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3x myc egfp omp25/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    3x myc egfp omp25 - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    pmxs ires gfp gift  (Addgene inc)
    94
    Addgene inc pmxs ires gfp gift
    Pmxs Ires Gfp Gift, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs ires gfp gift/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    pmxs ires gfp gift - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    c myc  (Addgene inc)
    94
    Addgene inc c myc
    C Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c myc/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    c myc - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    pmxs hc myc  (Addgene inc)
    94
    Addgene inc pmxs hc myc
    Pmxs Hc Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs hc myc/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    pmxs hc myc - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    pmxs hc l myc  (Addgene inc)
    94
    Addgene inc pmxs hc l myc
    Pmxs Hc L Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs hc l myc/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    pmxs hc l myc - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    ldha acgatcagcagcttgcagtg idt n a recombinant dna pmxs c myc addgene plasmid  (Addgene inc)
    98
    Addgene inc ldha acgatcagcagcttgcagtg idt n a recombinant dna pmxs c myc addgene plasmid
    Ldha Acgatcagcagcttgcagtg Idt N A Recombinant Dna Pmxs C Myc Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ldha acgatcagcagcttgcagtg idt n a recombinant dna pmxs c myc addgene plasmid/product/Addgene inc
    Average 98 stars, based on 1 article reviews
    ldha acgatcagcagcttgcagtg idt n a recombinant dna pmxs c myc addgene plasmid - by Bioz Stars, 2026-03
    98/100 stars
    		  Buy from Supplier
    pmxs myc plasmid  (Addgene inc)
    93
    Addgene inc pmxs myc plasmid
    Pmxs Myc Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs myc plasmid/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pmxs myc plasmid - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    pmxs c myc  (Addgene inc)
    93
    Addgene inc pmxs c myc
    Pmxs C Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs c myc/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pmxs c myc - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier

    Image Search Results